Belize - Belize News - Channel5Belize.com - Great Belize Productions - Belize Breaking News
Home » Featured, Miscellaneous, People & Places » DNA now tested in Belize
Jan 31, 2013

DNA now tested in Belize

If you’re a fan of popular television shows like CSI, Criminal Minds or Law and Order, then you probably know all about DNA—or at least, you know that Police can use DNA to solve all manner of serious crimes. If you’ve never watched those shows, but you like the daytime drama of Maury or Jerry Springer, you also know all about DNA from episodes entitled – Who’s Your Baby’s Daddy! As old as the practice of DNA testing is, it’s not done in Belize – not yet, at least. But the National Forensic Science Service is making a first and critical step as that unit conducted a Belize Population Genetic Study aimed at gathering information which will be vital to the establishment of DNA testing. Freelance Reporter, Mike Rudon, has that story.

 

Diana Bol, Forensic Analyst

“What we are doing, we are doing a research study in collaboration with the University of North Texas. We are looking at the different profiles of the country of Belize. as you know Belize is very rich with the different diverse ethnic groups and you might have similarities between the ethnic groups and differences between them as well. So what we are doing, we are looking at the different DNA markers within individuals to see what the trends in our population look like. DNA is—from person to person—ninety-nine percent the same, but it is that one percent that makes us unique. So it is looking at the difference in that one percent that this study will be focused on.”

 

Mike Rudon, Reporting

Diana Bol has been working in this field since 1994, and she says that the information gathered today at this site set up by the National Forensic Science Service is critical if Belize is to catch up with the rest of the region and the world, at least as far as DNA testing is concerned.

 

Diana Bol

The regions around us already have this study in place. This study is needed because in Forensics, it is comparison. So for us to do DNA on any case, we need to have this standard so that we can break it down into a scientific equation where we can say between one and a million, you are on target with this being a match. So that is what we are looking at. This study is just one step towards establishing DNA in Belize.”

 

Diana Bol

Convincing people to go give a DNA sample – now that’s a horse of a totally different color. It sounds painful, and complicated, and intrusive. But it actually wasn’t. The entire process took less than a minute, from the recording of the sex and ethnicity of the volunteer….to a swab of the inside of the mouth…to sealing the sample. Totally anonymous and pain-free! Even I did it.

 

Diana Bol

“The government has indicated that DNA to be established in Belize and we have commenced that project to do DNA in Belize. At this moment, the Forensic laboratory, we do cases, we study the cases that are being sent to us to see the potential DNA and have been trying to outsource for DNA to actually come about with these cases. So yes, this is one step for us and—to maintain it in Belize—we need to have studies like these done for our country.”

 

Currently samples are being sent to Jamaica for testing, a process which takes anywhere between two and three weeks. At about eleven this morning, when we were there, only about twenty persons had visited the booth to submit their samples. The unit needs three hundred samples to conduct a comprehensive study. Mike Rudon for News Five.

 

According to members of the National Forensic Science Service, a lot of the credit for the conducting of the genetic study and push for DNA testing in Belize goes to Shahida Flores, a Belizean studying forensics at the University of North Texas. Flores, we are told, plans to return to Belize to work in the field. If you didn’t submit your sample today but would like to do so, a booth will be set up at the B.D.F. Family Fair at Price Barracks on Saturday.       


Viewers please note: This Internet newscast is a verbatim transcript of our evening television newscast. Where speakers use Kriol, we attempt to faithfully reproduce the quotes using a standard spelling system.

Advertise Here

12 Responses for “DNA now tested in Belize”

  1. Earl Grey says:

    Will THIS … REALLY MAKE a DIFFERENCE in FIGHTING CRIME????????????

  2. pgbk87 says:

    @ Earl Grey

    This has nothing to do with fighting crime…. This is about getting a genetic profile for Belizeans to find out our relation to one another, our racial admixture, our risk of hereditary diseases. For those of non-Native descent, it will help clarify where in Africa (Europe, India, etc…) we come from…

    Things that are just as important as fighting crime.

  3. freddy says:

    this will work if the goverment implement it.with all the political drama going on in Belize the test will misteriously disapair because of corruption.

  4. cayobway says:

    well said freddy.

  5. GOB Worker says:

    GOB should impliment such things like these that will benefit, ant OFCOARSE this will help in making Our Belize crimeless. ever since, Belize wants to copy negative things from other countires. things that wnt make any good to our country, like Yes to same sex partners and u name it all. i strongly agree for this type of thing (DNA Test) to be proven in Belize. Itr has taken too long to reach anyway.

  6. Bear says:

    Anything to bring modern DNA capability to the Jewel, where eventually it can be used to solve serious crimes.

    A RELATED GOOD IDEA: Require EVERY immigrant to give a DNA sample before being naturalized, getting a work permit, etc., so if they commit a crime, it will be easier to identify them. Immigration isn’t a right, so if they don’t want to give a sample, they can just stay out of the Jewel. {I wish I could claim credit for the idea, but I just read that some politician in the states proposed it there. but if it’s a good idea, let’s steal it!)

  7. thetruthaboutforensics says:

    @Earl Grey: If you would have gone out yesterday and talked to the lab personnel collecting samples and read the additional material that was provided and maybe even volunteered a sample yourself, you would have a better idea of how this study will make a difference in fighting crime.

    @pgbk87: This study is not to determine racial admixture, risk of hereditary diseases or ancestral descent. It targets a very specific set of autosomal DNA markers that have been picked out for use in forensic DNA and human identification.

    The genetic information from all the DNA markers from all the volunteers will be combined and statistical calculations will be made to get an idea of how frequent or rare certain DNA markers are in the Belize population. This will play an important role if DNA evidence is ever presented in a Belize courtroom because some sort of statistical support is extremely valuable in that type of case.

    @freddy: I doubt that the results of this study will ‘mysteriously disappear because of corruption’. There are still some good people left in the world and in Belize.

  8. sobering reflections says:

    sobering reflections

  9. Initiate says:

    Thanks thetruthaboutforensics

    I wish you would explain then a little further how and why exactly a DNA Marker is so important for.

    What’s so grand of a rare DNA marker ?

    Example, please,

    many thanks!!

  10. thetruthaboutforensics says:

    I realize this might be a little confusing but hopefully it helps answer your question. It’s a combination of inheritance and statistics (biostatistics) that makes these DNA markers important to forensics.

    Very simply, you can think of DNA as a very long alphabet (think 3.2 billion letters long) that has only 4 letters A, C, T, G (these are representative of the 4 chemical bases of DNA) and these letters can be repeated as many times as necessary.
    …ACTGGTAGCTAGCTAGCCCATAGCATGCCCTTGAAGTACATGCATGCATGCATGCATGCGAT…..

    Biologically, this ‘alphabet’ is further broken down into 23 compartments (chromosomes).

    Chromosome 1: …ACTGGTAGCTAGCTAGCCCA…
    Chromosome 2: …TAGCATGCCCTTGA…
    Chromosome 3: …AGTACATGCATGCATGCATGCATGCGAT…
    etc…

    Each person has 2 sets of these for a total of 46 chromosomes, one set is inherited from their mother and the other set from their father (so, biologically speaking, they really are half of their mom and half of their dad). The set they inherit from their mother looks a little different that the set inherited from their father at several DNA markers. A DNA marker is just one location on this alphabet that is several letters long.

    From Mother:
    Chromosome 1: …ACTGGTAGCTAGCTAGCCCA…
    Chromosome 2: …TAGCATGCCCTTGA…
    Chromosome 3: …AGTACATGCATGCATGCATGCATGCGAT…
    etc…

    From Father :
    Chromosome 1: …ACTGGTAGCTAGCTAGCTAGCTAGCCCA…
    Chromosome 2: …TAGCATGCCCTTGA…
    Chromosome 3: …AGTACATGCATGCATGCATGCGAT…
    etc…

    In forensic DNA, about 13 of these DNA markers are looked at. The DNA markers are further known as short tandem repeats, meaning that they are a short sequence of letters (4 letters in this case) that follow right behind each other. Taking a closer look:

    From Mother:
    Chromosome 1: …actgg.TAGC.TAGC.TAGC.cca…
    Chromosome 2: …TAGCATGCCCTTGA…
    Chromosome 3: …agta.CATG.CATG.CATG.CATG.CATG.cgat…
    etc…

    From Father :
    Chromosome 1: …actgg.TAGC.TAGC.TAGC.TAGC.TAGC.cca…
    Chromosome 2: …TAGCATGCCCTTGA…
    Chromosome 3: …agta.CATG.CATG.CATG.CATG.cgat…
    etc…

    So, in this example, at a DNA marker on Chromosome 1, this person has inherited 3 repeats from their mother and 5 repeats from their father. At a DNA marker on Chromosome 3, this person has inherited 5 repeats from their mother and 4 repeats from their father.
    So, their genotype (that is the combination of both of their repeat numbers) at these two DNA markers are:
    Chr 1, DNA marker #1: 3,5
    Chr 3, DNA marker #1: 4,5

    Remember: this is only looking at two DNA markers! So, that’s the basic biology of it but now you have to go in to statistics. Also, these ‘inheritance’ events are independent of each other, meaning that inheritance of a 3 will not predict inheritance of a 5, it’s completely random, etc.

    Going in to population genetics (the purpose of this study): if you look at Chr 1, DNA marker # 1 for 1000 volunteers, the combined repeats that were seen are: 3,4,5,6,7,8 repeats. 3 was seen in 10% of the population, 4 in 5%, 5 in 15%, 6 in 30%, 7 in 35% and 8 in 5% (has to add up to 100%). This means that this person’s genotype (both numbers) is seen: 3 at 10% (0.1) and 5 at 15% (0.15) = (0.1)(0.5) = 0.015 or 1.5%. This genotype would only be seen in 1.5% of the population. So, if your population is 10,000 people, 150 people should have this genotype at this DNA marker. Now, if you look at the other marker and end up with a genotype frequency for the 4 and 5 of 0.02 (2%), since these are independent events, the chance of seeing someone in the population with a 3,5 at the first marker and a 4,5 at the second marker is (0.015)(0.02) = 0.0003 (0.03%). Only 3 people in the population of 10,000 will have this combination. And this number gets smaller and smaller for each DNA marker you examine.

    So, in a sense, this is how you would have a ‘rare’ DNA marker or a ‘common’ DNA marker, it depends on how often it is seen in the population.

  11. KDJM says:

    @thetruthaboutforensics That was very informative. I did go and offer my DNA. I believe that we need to contribute to these things as they help to improve our country. I will contribute to anything that will help solve crime, and of course I am curious to know the results. DNA is a very interesting thing.

    While a understand why some of you are skeptical about using anything to fight crime in belize, this is a step in the right direction. Now … if only we’d get some better police officers…. and politicians.. that would definitely make the change.

  12. Kellie says:

    I am a Forensic DNA Analyst working for a US state crime lab. I am interested to know what advances have been made in Belize to establish a convicted offender DNA database and whatever career opportunities will be available. Thank you.

Comments are closed